Human TREM1/CD354/TREM-1 ORF/cDNA clone-Adenovirus plasmid (NM_018643.4)

Cat. No.: pGMAD000291
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TREM1/CD354/TREM-1 adenoviral expression plasmid for TREM1 adenovirus packaging, TREM1 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to TREM-1/CD354/TREM1/TREM1/CD354 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAD000291
Gene Name TREM1
Accession Number NM_018643.4
Gene ID 54210
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 705 bp
Gene Alias CD354,TREM-1
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGAGGAAGACCAGGCTCTGGGGGCTGCTGTGGATGCTCTTTGTCTCAGAACTCCGAGCTGCAACTAAATTAACTGAGGAAAAGTATGAACTGAAAGAGGGGCAGACCCTGGATGTGAAATGTGACTACACGCTAGAGAAGTTTGCCAGCAGCCAGAAAGCTTGGCAGATAATAAGGGACGGAGAGATGCCCAAGACCCTGGCATGCACAGAGAGGCCTTCAAAGAATTCCCATCCAGTCCAAGTGGGGAGGATCATACTAGAAGACTACCATGATCATGGTTTACTGCGCGTCCGAATGGTCAACCTTCAAGTGGAAGATTCTGGACTGTATCAGTGTGTGATCTACCAGCCTCCCAAGGAGCCTCACATGCTGTTCGATCGCATCCGCTTGGTGGTGACCAAGGGTTTTTCAGGGACCCCTGGCTCCAATGAGAATTCTACCCAGAATGTGTATAAGATTCCTCCTACCACCACTAAGGCCTTGTGCCCACTCTATACCAGCCCCAGAACTGTGACCCAAGCTCCACCCAAGTCAACTGCCGATGTCTCCACTCCTGACTCTGAAATCAACCTTACAAATGTGACAGATATCATCAGGGTTCCGGTGTTCAACATTGTCATTCTCCTGGCTGGTGGATTCCTGAGTAAGAGCCTGGTCTTCTCTGTCCTGTTTGCTGTCACGCTGAGGTCATTTGTACCCTAG
ORF Protein Sequence MRKTRLWGLLWMLFVSELRAATKLTEEKYELKEGQTLDVKCDYTLEKFASSQKAWQIIRDGEMPKTLACTERPSKNSHPVQVGRIILEDYHDHGLLRVRMVNLQVEDSGLYQCVIYQPPKEPHMLFDRIRLVVTKGFSGTPGSNENSTQNVYKIPPTTTKALCPLYTSPRTVTQAPPKSTADVSTPDSEINLTNVTDIIRVPVFNIVILLAGGFLSKSLVFSVLFAVTLRSFVP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T89780-Ab Anti-TREM1/ CD354/ TREM-1 monoclonal antibody
    Target Antigen GM-Tg-g-T89780-Ag TREM1 VLP (virus-like particle)
    ORF Viral Vector pGMAD000291 Human TREM1 Adenovirus plasmid
    ORF Viral Vector vGMAD000291 Human TREM1 Adenovirus particle


    Target information

    Target ID GM-T89780
    Target Name TREM-1/CD354/TREM1
    Gene Group Identifier
    （Target Gene ID in Homo species)         		54210
    Gene ID 100054285 (Equus caballus), 101099551 (Felis catus), 301229 (Rattus norvegicus), 404547 (Bos taurus)
    54210 (Homo sapiens), 58217 (Mus musculus), 608994 (Canis lupus familiaris), 693558 (Macaca mulatta)
    Gene Symbols & Synonyms TREM1,Trem1,TREM-1,CD354
    Target Alternative Names CD354,TREM-1,TREM1,Trem1,Triggering receptor expressed on monocytes 1,Triggering receptor expressed on myeloid cells 1
    Uniprot Accession Q6QUN5,Q9JKE2,Q9NP99
    Additional SwissProt Accessions: Q6QUN5,Q9NP99,Q9JKE2
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000017436, ENSBTAG00000017593, ENSG00000124731, ENSMUSG00000042265, ENSCAFG00845015313, ENSMMUG00000003674
    Target Classification Pathway


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.